Nuevas técnicas moleculares de determinación taxonómica en Heterobranchia

El uso de técnicas moleculares para investigar la historia evolutiva de grupos animales y definir linajes monofiléticos se ha expandido exponencialmente en las últimas décadas, convirtiéndose en uno de los pasos esenciales para lograr una buena taxonomía integrativa.

La taxonomía integrativa es un campo en constante evolución basada en estudios multidisciplinarios que combinan diferentes tipos de caracteres informativos que pudieran ser diagnósticos en diferentes niveles taxonómicos y que a menudo se utilizan para dilucidar las reconstrucciones filogenéticas que se entendían mal en el pasado. Así, la sistemática de muchos taxones se ha resuelto recientemente mediante la combinación de datos moleculares, ecológicos, de comportamiento, morfológicos y químicos (Ekimova et al., 2015; Fernández-Vilert et al., 2021; Furfaro et al., 2018; Furfaro et al., 2021; Goodheart et al., 2018; Padula et al., 2016; Schillo et al., 2019).

En cuanto al análisis molecular, contínuamente se está buscando nuevos marcadores genéticos que puedan ser diagnósticos a diferentes niveles taxonómicos y que se puedan sumar a los ya existentes. El ADN mitocondrial (ADNmt) es, en la mayoría de los casos, la mejor herramienta para diferenciar los niveles taxonómicos más bajos, como especies y géneros, así como para investigar la diversidad críptica y eventos de especiación recientes (Furfaro et al., 2021; Pola et al., 2007; Pola et al., 2012; Furfaro et al., 2016), sin embargo también tiene ciertas limitaciones que se presentan en forma de errores. Para evitar dichos errores se suelen incluir en los análisis marcadores nucleares, pero éstos son poco o nada informativos en niveles taxonómicos inferiores (Furfaro et al., 2021; Furfaro et al., 2016b; Galià-Camps et al., 2020).

El estudio de los heterobranquios marinos

En los heterobranquios marinos (Mollusca, Gastropoda) su historia evolutiva, cuando se estudia a nivel familia, se reconstruye utilizando principalmente tres marcadores moleculares: dos genes mitocondriales, parte de la subunidad I de la citocromo oxidasa (COI) y parte del ribosoma subunidad 16S, así como el gen nuclear histona 3 (H3). Mediante estos marcadores se ha aclarado la sistemática de varias familias de heterobranquios y se han resuelto y corregido resultados erróneos derivados de estudios morfológicos previos (Ekimova et al., 2015; Padula et al., 2016; Fernández-Vilert et al., 2021).

Pero resulta que la secuencia primaria de algunas regiones del ARNr mitocondrial es hipervariable y difícil de alinear entre especies parecidas. Esta hipervariabilidad de ARNr también ocurre en el ARN 16S ribosómico mitocondrial (ARNr 16S), utilizado como marcador clásico, que se pliega en diferentes dominios y stem-loops (en español se conocen como “tallo-lazo”, “bucle en horquilla” o simplemente “horquilla”), un tipo de estructuras que se origina cuando dos regiones de una misma cadena, generalmente con una secuencia de nucleótidos complementaria si la leemos en sentidos opuestos, se empareja base a base para formar una doble hélice (o tallo) que acaba en un lazo (o bucle) de bases desemparejadas.

Un ejemplo de una secuencia de ARN que produciría una estructura en horquilla o tallo-bucle es la siguiente:
ACGUGCCACGAUUCAACGUGGCACAG
En esta secuencia, los nucleótidos en negrita, que son complementarios, se emparejarían formando el tallo, y la secuencia central no complementaria formaría el bucle. Fuente: Wikipedia

Cuando los alineamientos basados ​​en las secuencias primarias no son fáciles de lograr, es una práctica común y sugerida eliminar estas porciones para estabilizar la señal filogenética, de hecho existen programas específicos que ayudan a cortar estas regiones hipervariables, por ejemplo, el programa GBlocks (Castresana, 2000; Talavera & Castresana, 2007). La eliminación de estas regiones de alineación poco fiables del conjunto de datos es promovida por varios trabajos influyentes destinados a demostrar la mejora del apoyo estadístico de los análisis filogenéticos cuando se corta la aleatoriedad en las alineaciones de secuencia (Kück et al., 2010; Privman et al., 2012). Sin embargo, esta práctica significa que, inevitablemente, algunas regiones muy informativas, fuente de caracteres diagnósticos, a menudo no se tienen en cuenta.

La información derivada de la estructura plegada del ARNr 16S no se ha utilizado hasta ahora en moluscos, a excepción de dos trabajos de Furfaro et al. (2016b; 2016c), en los que se utilizó este marcador genético con un par de babosas marinas simpátricas y en los que se reportó una diversidad estructural 2D del ARNr 16S, principalmente utilizando el tallo-bucle L7 altamente variable y el L13 (Lydeard et al., 2000), lo que demuestra que la información de las estructuras secundarias del ARN es una valiosa herramienta de diagnóstico adicional para la taxonomía integrativa y para la delimitación de especies (Furfaro et al., 2016b; 2016c).

El caso de los Myrrhinidae

En esta línea Furfaro & Mariottini (2021) han utilizado la comparación de los resultados de los análisis filogenéticos de un conjunto de datos concatenados (el gen H3 nuclear y los marcadores mitocondriales COI y 16S), para investigar la sistemática a un nivel taxonómico superior al nivel de especie. En particular, se utilizó como caso de estudio un clado polifilético (Furfaro & Mariottini, 2020) compuesto por cuatro géneros clasificados en la familia Myrrhinidae Bergh, 1905: Dondice Marcus Er. 1958 (4 especies); Godiva Macnae, 1954 (4 especies); Hermissenda Bergh, 1879 (3 especies) y Phyllodesmium Ehrenberg, 1831 (27 especies). Eligieron esta familia como ejemplo para investigar la capacidad de los análisis de estructura de plegado 2D de dar información útil sobre la sistemática de este grupo de animales mediante la observación de características morfológicas y moleculares. La elección se basó en la peculiaridad de los géneros involucrados, sus historias filogenéticas no resueltas y su estrategia defensiva única: la capacidad de autotomizar sus cerata si se les molesta.

Después de un análisis de estructura de tallo-bucle de la molécula de ARNr 16S, se eligió el tallo-bucle L7 específico y altamente variable como el más divergente e informativo para este grupo y se reveló que era diagnóstico para discriminar inequívocamente diferentes estructuras de ARNr 16S. Este enfoque, basado en la descripción de la “morfología molecular” de esta región muy variable del ARNr 16S mitocondrial (Furfaro et al., 2016b), puede considerarse como una herramienta adicional para la delimitación de especies y la taxonomía integradora en Heterobranchia y más generalmente en los moluscos marinos.

Fuente:             Furfaro & Mariottini (2021)

Los resultados confirmaron la validez de los géneros Godiva, Hermissenda y Phyllodesmium como se conciben tradicionalmente, pero también les llevaron a proponer excluir Dondice banyulensis del género Dondice y asignarlo como especie tipo de un nuevo género Nemesis gen. nov.. Sin embargo, la presencia de un homónimo mayor, que tiene prioridad sobre el recientemente declarado Nemesis Furfaro & Mariottini, 2021, anuló este último nombre del género e invocó la necesidad de un nombre de reemplazo de acuerdo con las reglas de la ICZN. Por tanto los autores propusieron Nemesignis como el nuevo nombre de reemplazo (Furfaro & Mariottini, 2021b), en virtud del artículo 60.3 de la ICZN y, en consecuencia, Nemesignis banyulensis (Portmann & Sandmeier, 1960) como su especie tipo.

Nemesignis banyulensis by Miquel Pontes

Nemesignis banyulensis por Miquel Pontes

Además, el género monoespecífico Nanuca (anteriormente clasificado dentro de la familia Facelinidae) se sinonimizaba con el género Dondice y, en consecuencia, el taxón Nanuca sebastiani pasaba a llamarse Dondice sebastiani comb. nov. en la familia Myrrhinidae. Sin embargo, como Nanuca Er. Marcus, 1957 tiene prioridad sobre Dondice Er. Marcus, 1958, resultó que las especies de este clado Dondice deben clasificarse bajo Nanuca, quedando así: Nanuca galaxiana (Millen & Hermosillo, 2012), N. occidentalis (Engel, 1925), N. parguerensis (Brandon y Cutress, 1985) y N. trainitoi (Furfaro & Mariottini, 2020).

Conclusiones

El enfoque “morfológico molecular” del ARNr 16S reveló ser una herramienta taxonómica poderosa para delimitar tanto a nivel de especie como de género y es una forma útil de recuperar información que generalmente se pierde en los análisis filogenéticos. Esperamos ver pronto nuevos trabajos empleando esta interesante metodología.

Referencias

  • Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol., 17: 540−552
  • Ekimova, I., Korshunova, T., Schepetov, D., Neretina, T., Sanamyan, N. & Martynov, A. (2015) Integrative systematics of northern and Arctic nudibranchs of the genus Dendronotus (Mollusca, Gastropoda), with descriptions of three new species. Zool. J. Linn. Soc., 173: 841–886
  • Fernández-Vilert, R., Giribet, G., Salvador, X. & Moles, J. (2021) Assessing the systematics of Tylodinidae in the Mediterranean Sea and Eastern Atlantic Ocean: Resurrecting Tylodina rafinesquii Philippi, 1836 (Heterobranchia: Umbraculida). J. Molluscan Stud. , 87: eyaa031
  • Furfaro, G., Modica, M.V., Oliverio, M. & Mariottini, P. (2016) A DNA-barcoding approach to the phenotypic diversity of Mediterranean species of Felimare Ev. Marcus & Er. Marcus, 1967 (Mollusca: Gastropoda), with a preliminary phylogenetic analysis. Ital. J. Zool., 83: 195–207  DOI:10.1080/11250003.2016.1150525.
  • Furfaro, G., Picton, B., Martynov, A. & Mariottini, P. (2016b) Diaphorodoris alba Portmann & Sandmeier, 1960 is a valid species: Molecular and morphological comparison with D. luteocincta (M. Sars, 1870). Zootaxa, 4193: 304–316.
  • Furfaro, G., Mariottini, P., Modica, M.V., Trainito, E., Doneddu, M. & Oliverio, M. (2016c) Sympatric sibling species: The case of Caloria elegans and Facelina quatrefagesi (Gastropoda: Nudibranchia). Sci. Mar., 80: 511–520
  • Furfaro, G., Salvi, D., Mancini, E. & Mariottini, P. (2018) A multilocus view on Mediterranean aeolid nudibranchs (Mollusca): Systematics and cryptic diversity of Flabellinidae and Piseinotecidae. Mol. Phylogenetic Evol., 118: 13–22, DOI: 10.1016/j.ympev.2017.09.001
  • Furfaro, G. & Mariottini, P. (2020) A new Dondice Marcus Er. 1958 (Gastropoda: Nudibranchia) from the Mediterranean Sea reveals interesting insights into the phylogenetic history of a group of Facelinidae taxa. Zootaxa, 477731: 1–22
  • Furfaro, G., Salvi, D., Trainito, E., Vitale, F. & Mariottini, P. (2021) When morphology does not match phylogeny: The puzzling case of two sibling nudibranchs (Gastropoda). Zool. Scr. 2021, 1–16, DOI: 10.1111/zsc.12484.
  • Furfaro, G. & Mariottini, P. (2021) Looking at the Nudibranch Family Myrrhinidae (Gastropoda, Heterobranchia) from a Mitochondrial ‘2D Folding Structure’ Point of View. Life 11: 583. DOI: 10.3390/life11060583
  • Furfaro, G. & Mariottini, P. (2021b) Nemesignis, a replacement name for Nemesis Furfaro & Mariottini, 2021 (Mollusca, Gastropoda, Myrrhinidae), preoccupied by Nemesis Risso, 1826 (Crustacea, Copepoda). Life 11: 809. DOI: 10.3390/life11080809
  • Galià-Camps, C., Carmona, L., Cabrito, A. & Ballesteros, M. (2020) Double trouble. A cryptic first record of Berghia marinae Carmona, Pola, Gosliner & Cervera, 2014 in the Mediterranean Sea. Mediterr. Mar. Sci., 21: 191–200, DOI: 10.12681/Mms.20026.
  • Goodheart, J.A., Bleidißel, S., Schillo, D., Strong, E., Ayres, D.L., Preisfeld, A., Collins, A.G., Cummings, M.P. & Wägele, H. (2018) Comparative morphology and evolution of the cnidosac in Cladobranchia (Gastropoda: Heterobranchia: Nudibranchia). Front. Zool. , 15: 1–18
  • Kück, P., Meusemann, K., Dambach, J., Thormann, B., von Reumont, B.M., Wägele, J.W.; & Misof, B. (2010) Parametric and non-parametric masking of randomness in sequence alignments can be improved and leads to better resolved trees. Front. Zool., 7: 1–12
  • Lydeard, C., Holznagel, W.E., Schnare, M.N. & Gutell, R.R. (2000) Phylogenetic analysis of molluscan mitochondrial LSU rDNA sequences and secondary structures. Mol. Phylogenetics Evol., 15: 83−102
  • Martynov, A., Mehrotra, R., Chavanich, S., Nakano, R., Kashio, S., Lundin, K. & Korshunova, T. (2019) The extraordinary genus Myja is not a tergipedid, but related to the Facelinidae s. str. with the addition of two new species from Japan (Mollusca, Nudibranchia). ZooKeys, 818: 89
  • Padula, V., Bahia, J., Stöger, I., Camacho-García, Y., Malaquias, M.A.E., Cervera, J.L. & Schrödl, M. (2016) A test of color-based taxonomy in nudibranchs: Molecular phylogeny and species delimitation of the Felimida clenchi (Mollusca: Chromodorididae) species complex. Mol. Phylogenetics Evol. , 103: 215–229
  • Pola, M., Cervera, J.L. & Gosliner, T.M. (2007) Phylogenetic relationships of Nembrothinae (Mollusca: Doridacea: Polyceridae) inferred from morphology and mitochondrial DNA. Mol. Phylogenetics Evol., 43: 726–742.
  • Pola, M., Camacho-Garía, Y.E. & Gosliner, T.M. (2012) Molecular data illuminate cryptic nudibranch species: The evolution of the Scyllaeidae (Nudibranchia: Dendronotina) with a revision of Notobryon. Zool. J. Linn. Soc., 165: 311–336.
  • Privman, E., Penn, O. & Pupko, T. (2012) Improving the performance of positive selection inference by filtering unreliable alignment regions. Mol. Biol. Evol., 29: 1−5.
  • Schillo, D., Wipfler, B., Undap, N., Papu, A., Boehringer, N., Eisenbarth, J.H. & Wägele, H. (2019) Description of a new Moridilla species from North Sulawesi, Indonesia (Mollusca: Nudibranchia: Aeolidioidea)—Based on MicroCT, histological and molecular analyses. Zootaxa, 4652: 265–295
  • Talavera, G. & Castresana, J. (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol., 56: 564−577

Citar este artículo como:

Pontes, Miquel (2021) "Nuevas técnicas moleculares de determinación taxonómica en Heterobranchia" en OPK-Opistobranquis. Publicado: 12/08/2021. Accedido: 28/09/2021. Disponible en (https://opistobranquis.info/es/KDGAq)

Para poder copiar esta cita clique el botón de la derecha.

Pontes, Miquel

Informático de profesión, es fotógrafo submarino y naturalista aficionado. Submarinista desde 1994, su “logbook” cuenta con centenares de inmersiones en el mar Mediterráneo, mar Caribe y mar Rojo y en los océanos Atlántico, Índico y Pacífico. Fundador del Grupo de Estudios M@re Nostrum en 1996, socio fundador de Grup de Recerca en Opistobranquis de Catalunya en 2010, socio fundador del Grup de Recerca VIMAR (Vida Marina) en 2012. Co-autor y webmaster del web dedicado a los moluscos opistobranquios del Mediterráneo e Iberia OPK - Opistobranquis, co-autor del libro "Els nudibranquis del mar català" publicado en 2020 por Brau Edicions, descubrió el interesante mundo de los opistobranquios en 1997 de la mano de sus compañeros de inmersión y desde entonces ha sido una línea de trabajo continuada, aportando fotos submarinas, observaciones hechas en el medio natural y colaborando en la difusión de este área del conocimiento. Autor y co-autor de múltiples publicaciones científicas sobre moluscos opistobranquios (y otros grupos animales), ha participado y participa en todo tipo de proyectos divulgativos (libros, revistas, webs, conferencias, exposiciones …) como medio para difundir su interés principal: proteger los mares y los seres que los habitan. Desde 2019 es coordinador del grupo VIMAR (Vida Marina) y es webmaster de esta página web.