Noves tècniques moleculars de determinació taxonòmica en Heterobranchia

L’ús de tècniques moleculars per a investigar la història evolutiva dels grups animals i definir llinatges monofilètics s’ha expandit exponencialment en les últimes dècades, convertint-se en un dels passos essencials per aconseguir una bona taxonomia integrativa.

La taxonomia integrativa és un camp en constant evolució basat en estudis multidisciplinaris que combinen diferents tipus de caràcters informatius que poguessin ser diagnòstics en diferents nivells taxonòmics i que sovint s’utilitzen per dilucidar les reconstruccions filogenètiques que s’entenien malament en el passat. Així, la sistemàtica de molts tàxons s’ha resolt recentment mitjançant la combinació de dades moleculars, ecològiques, de comportament, morfològiques i químiques (Ekimova et al., 2015; Fernández-Vilert et al., 2021; Furfaro et al., 2018; Furfaro et al., 2021; Goodheart et al., 2018; Padula et al., 2016; Schillo et al., 2019).

Pel que fa a l’anàlisi molecular, contínuament s’estan buscant nous marcadors genètics que puguin ser diagnòstics a diferents nivells taxonòmics i que es puguin sumar als ja existents. L’ADN mitocondrial (ADNmt) és, en la majoria dels casos, la millor eina per diferenciar els nivells taxonòmics més baixos, com ara espècies i gèneres, així com per investigar la diversitat críptica i esdeveniments d’especiació recents (Furfaro et al., 2021; Pola et al., 2007; Pola et al., 2012; Furfaro et al., 2016), però també té certes limitacions que es presenten en forma d’errors. Per evitar aquests errors se solen incloure marcadors nuclears en les anàlisis, però aquests són poc o gens informatius en els nivells taxonòmics inferiors (Furfaro et al., 2021; Furfaro et al., 2016b; Galià-Camps et al., 2020).

L’estudi dels heterobranquis marins

En els heterobranquios marins (Mollusca, Gastropoda) la història evolutiva, quan s’estudia a nivell familia, es reconstrueix utilitzant principalment tres marcadors moleculars: dos gens mitocondrials, part de la subunitat I de la citocrom-oxidasa (COI) i part del ribosoma subunitat 16S, així com el gen nuclear histona 3 (H3). Mitjançant aquests marcadors s’ha aclarit la sistemàtica de diverses famílies de heterobranquis i s’han resolt i corregit resultats erronis derivats d’estudis morfològics previs (Ekimova et al., 2015; Padula et al., 2016; Fernández-Vilert et al., 2021) .

Però resulta que la seqüència primària d’algunes regions de l’ARNr mitocondrial és hipervariable i difícil d’alinear entre espècies semblants. Aquesta hipervariabilidad d’ARNr també passa amb l’ARN 16S ribosòmic mitocondrial (ARNr 16S), utilitzat com a marcador clàssic, que es plega en diferents dominis i stem-loops (en català es coneixen com a “tija en bucle”), un tipus d’estructures que s’origina quan dues regions d’una mateixa cadena, generalment amb una seqüència de nucleòtids complementària si la llegim en sentits oposats, s’aparella base a base per formar una doble hèlix (o tija) que acaba en un bucle de bases desaparellades.

Un exemple d’una seqüència d’ARN que produiria una estructura de tija en bucle és la següent:
ACGUGCCACGAUUCAACGUGGCACAG
En aquesta seqüència, els nucleòtids en negreta, que son complementaris, s’emparellarien formant la tija, i la seqüència central no complementaria formaria el bucle. Font: Wikipedia

Quan els alineaments basats en les seqüències primàries no són fàcils d’aconseguir, és una pràctica comuna i suggerida eliminar aquestes porcions per estabilitzar el senyal filogenètica, de fet hi ha programes específics que ajuden a tallar aquestes regions hipervariables, per exemple, el programa GBlocks (Castresana, 2000; Talavera & Castresana, 2007). L’eliminació d’aquestes regions d’alineació poc fiables del conjunt de dades és promoguda per diversos treballs influents destinats a demostrar la millora del suport estadístic de les anàlisis filogenètics quan es talla l’aleatorietat en les alineacions de seqüència (Kück et al., 2010; Privman et al., 2012). No obstant això, aquesta pràctica significa que, inevitablement, algunes regions molt informatives, font de caràcters diagnòstics, sovint no es tenen en compte.

La informació derivada de l’estructura plegada de l’ARNr 16S no s’ha utilitzat fins ara en mol·luscs, a excepció de dos treballs de Furfaro et al. (2016b; 2016c), en els quals es va utilitzar aquest marcador genètic amb un parell de llimacs marins simpàtrics i en els quals es va reportar una diversitat estructural 2D de l’ARNr 16S, principalment utilitzant les tiges en bucle L7 altament variable i L13 (Lydeard et a l’ ., 2000), el que demostra que la informació de les estructures secundàries de l’ARN és una valuosa eina de diagnòstic addicional per a la taxonomia integrativa i per a la delimitació d’espècies (Furfaro et al., 2016b; 2016c).

El cas dels Myrrhinidae

En aquesta línia Furfaro & Mariottini (2021) han utilitzat la comparació dels resultats de les anàlisis filogenètics d’un conjunt de dades concatenades (el gen H3 nuclear i els marcadors mitocondrials COI i 16S), per investigar la sistemàtica a un nivell taxonòmic superior al nivell d’espècie. En particular, es va utilitzar com a cas d’estudi un clade polifilètic (Furfaro & Mariottini, 2020) compost per quatre gèneres classificats dins la família Myrrhinidae Bergh, 1905: Dondice Marcus Er. 1958 (4 espècies); Godiva Macnae, 1954 (4 espècies); Hermissenda Bergh, 1879 (3 espècies) i Phyllodesmium Ehrenberg, 1831 (27 espècies). Van triar aquesta família com a exemple per investigar la capacitat de les anàlisis d’estructura de plegat 2D de donar informació útil sobre la sistemàtica d’aquest grup d’animals mitjançant l’observació de característiques morfològiques i moleculars. L’elecció va estar basada en la peculiaritat dels gèneres involucrats, les seves històries filogenètiques no resoltes i la seva estratègia defensiva única: la capacitat de autotomizar els cerata si se’ls molesta.

Després d’una anàlisi de l’estructura de tija en bucle de la molècula d’ARNr 16S, es va triar la tija-bucle L7 específica i altament variable com la més divergent i informativa per a aquest grup i es va revelar que era diagnòstica per a discriminar inequívocament diferents estructures d’ARNr 16S. Aquest enfocament, basat en la descripció de la “morfologia molecular” d’aquesta regió molt variable de l’ARNr 16S mitocondrial (Furfaro et al., 2016b), pot considerar-se com una eina addicional per a la delimitació d’espècies i la taxonomia integradora en heterobranquis i, més generalment, en els mol·luscs marins.

Font:             Furfaro & Mariottini (2021)

Els resultats van confirmar la validesa dels gèneres Godiva, Hermissenda i Phyllodesmium com es concebien tradicionalment, però també els van portar a proposar excloure Dondice banyulensis del gènere Dondice i assignar-la com a espècie tipus d’un nou gènere Nemesis gen. nov. No obstant això, la presència d’un homònim major, que té prioritat sobre el recentment declarat Nemesis Furfaro & Mariottini, 2021, va anul·lar aquest últim nom de gènere i va invocar la necessitat d’un nom de reemplaçament d’acord amb les regles de la ICZN. Per tant els autors van proposar Nemesignis com el nou nom de reemplaçament (Furfaro & Mariottini, 2021b) en virtut de l’article 60.3 de la ICZN i, en conseqüència, Nemesignis banyulensis (Portmann & Sandmeier, 1960) com a la seva espècie tipus.

Nemesignis banyulensis by Miquel Pontes

Nemesignis banyulensis per Miquel Pontes

A més, el gènere monoespecífic Nanuca (anteriorment classificat dins la familia Facelinidae) es sinonimitzava amb el gènere Dondice i, en conseqüència, el taxó Nanuca sebastiani passava a dir-se Dondice sebastiani comb. nov. dins la familia Myrrhinidae. No obstant això, com Nanuca Er. Marcus, 1957 té prioritat sobre Dondice Er. Marcus, 1958, va resultar que les espècies d’aquest clade Dondice s’han de classificar sota Nanuca, quedant així: Nanuca galaxiana (Millen & Hermosillo, 2012), N. occidentalis (Engel, 1925), N. parguerensis (Brandon i Cutress, 1985) i N . trainitoi (Furfaro & Mariottini, 2020).

Conclusions

L’enfocament “morfològic molecular” de l’ARNr 16S va revelar ser una eina taxonòmica poderosa per delimitar tant a nivell d’espècie com de gènere i va ser una forma útil de recuperar informació que generalment es perd en les anàlisis filogenètiques. Esperem veure aviat nous treballs emprant aquesta interessant metodologia.

Referències

  • Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol., 17: 540−552
  • Ekimova, I., Korshunova, T., Schepetov, D., Neretina, T., Sanamyan, N. & Martynov, A. (2015) Integrative systematics of northern and Arctic nudibranchs of the genus Dendronotus (Mollusca, Gastropoda), with descriptions of three new species. Zool. J. Linn. Soc., 173: 841–886
  • Fernández-Vilert, R., Giribet, G., Salvador, X. & Moles, J. (2021) Assessing the systematics of Tylodinidae in the Mediterranean Sea and Eastern Atlantic Ocean: Resurrecting Tylodina rafinesquii Philippi, 1836 (Heterobranchia: Umbraculida). J. Molluscan Stud. , 87: eyaa031
  • Furfaro, G., Modica, M.V., Oliverio, M. & Mariottini, P. (2016) A DNA-barcoding approach to the phenotypic diversity of Mediterranean species of Felimare Ev. Marcus & Er. Marcus, 1967 (Mollusca: Gastropoda), with a preliminary phylogenetic analysis. Ital. J. Zool., 83: 195–207  DOI:10.1080/11250003.2016.1150525.
  • Furfaro, G., Picton, B., Martynov, A. & Mariottini, P. (2016b) Diaphorodoris alba Portmann & Sandmeier, 1960 is a valid species: Molecular and morphological comparison with D. luteocincta (M. Sars, 1870). Zootaxa, 4193: 304–316.
  • Furfaro, G., Mariottini, P., Modica, M.V., Trainito, E., Doneddu, M. & Oliverio, M. (2016c) Sympatric sibling species: The case of Caloria elegans and Facelina quatrefagesi (Gastropoda: Nudibranchia). Sci. Mar., 80: 511–520
  • Furfaro, G., Salvi, D., Mancini, E. & Mariottini, P. (2018) A multilocus view on Mediterranean aeolid nudibranchs (Mollusca): Systematics and cryptic diversity of Flabellinidae and Piseinotecidae. Mol. Phylogenetic Evol., 118: 13–22, DOI: 10.1016/j.ympev.2017.09.001
  • Furfaro, G. & Mariottini, P. (2020) A new Dondice Marcus Er. 1958 (Gastropoda: Nudibranchia) from the Mediterranean Sea reveals interesting insights into the phylogenetic history of a group of Facelinidae taxa. Zootaxa, 477731: 1–22
  • Furfaro, G., Salvi, D., Trainito, E., Vitale, F. & Mariottini, P. (2021) When morphology does not match phylogeny: The puzzling case of two sibling nudibranchs (Gastropoda). Zool. Scr. 2021, 1–16, DOI: 10.1111/zsc.12484.
  • Furfaro, G. & Mariottini, P. (2021) Looking at the Nudibranch Family Myrrhinidae (Gastropoda, Heterobranchia) from a Mitochondrial ‘2D Folding Structure’ Point of View. Life 11: 583. DOI: 10.3390/life11060583
  • Furfaro, G. & Mariottini, P. (2021b) Nemesignis, a replacement name for Nemesis Furfaro & Mariottini, 2021 (Mollusca, Gastropoda, Myrrhinidae), preoccupied by Nemesis Risso, 1826 (Crustacea, Copepoda). Life 11: 809. DOI: 10.3390/life11080809
  • Galià-Camps, C., Carmona, L., Cabrito, A. & Ballesteros, M. (2020) Double trouble. A cryptic first record of Berghia marinae Carmona, Pola, Gosliner & Cervera, 2014 in the Mediterranean Sea. Mediterr. Mar. Sci., 21: 191–200, DOI: 10.12681/Mms.20026.
  • Goodheart, J.A., Bleidißel, S., Schillo, D., Strong, E., Ayres, D.L., Preisfeld, A., Collins, A.G., Cummings, M.P. & Wägele, H. (2018) Comparative morphology and evolution of the cnidosac in Cladobranchia (Gastropoda: Heterobranchia: Nudibranchia). Front. Zool. , 15: 1–18
  • Kück, P., Meusemann, K., Dambach, J., Thormann, B., von Reumont, B.M., Wägele, J.W.; & Misof, B. (2010) Parametric and non-parametric masking of randomness in sequence alignments can be improved and leads to better resolved trees. Front. Zool., 7: 1–12
  • Lydeard, C., Holznagel, W.E., Schnare, M.N. & Gutell, R.R. (2000) Phylogenetic analysis of molluscan mitochondrial LSU rDNA sequences and secondary structures. Mol. Phylogenetics Evol., 15: 83−102
  • Martynov, A., Mehrotra, R., Chavanich, S., Nakano, R., Kashio, S., Lundin, K. & Korshunova, T. (2019) The extraordinary genus Myja is not a tergipedid, but related to the Facelinidae s. str. with the addition of two new species from Japan (Mollusca, Nudibranchia). ZooKeys, 818: 89
  • Padula, V., Bahia, J., Stöger, I., Camacho-García, Y., Malaquias, M.A.E., Cervera, J.L. & Schrödl, M. (2016) A test of color-based taxonomy in nudibranchs: Molecular phylogeny and species delimitation of the Felimida clenchi (Mollusca: Chromodorididae) species complex. Mol. Phylogenetics Evol. , 103: 215–229
  • Pola, M., Cervera, J.L. & Gosliner, T.M. (2007) Phylogenetic relationships of Nembrothinae (Mollusca: Doridacea: Polyceridae) inferred from morphology and mitochondrial DNA. Mol. Phylogenetics Evol., 43: 726–742.
  • Pola, M., Camacho-Garía, Y.E. & Gosliner, T.M. (2012) Molecular data illuminate cryptic nudibranch species: The evolution of the Scyllaeidae (Nudibranchia: Dendronotina) with a revision of Notobryon. Zool. J. Linn. Soc., 165: 311–336.
  • Privman, E., Penn, O. & Pupko, T. (2012) Improving the performance of positive selection inference by filtering unreliable alignment regions. Mol. Biol. Evol., 29: 1−5.
  • Schillo, D., Wipfler, B., Undap, N., Papu, A., Boehringer, N., Eisenbarth, J.H. & Wägele, H. (2019) Description of a new Moridilla species from North Sulawesi, Indonesia (Mollusca: Nudibranchia: Aeolidioidea)—Based on MicroCT, histological and molecular analyses. Zootaxa, 4652: 265–295
  • Talavera, G. & Castresana, J. (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol., 56: 564−577

Citeu aquest article com:

Pontes, Miquel (2021) "Noves tècniques moleculars de determinació taxonòmica en Heterobranchia" a OPK-Opistobranquis. Publicat: 12/08/2021. Accedit: 28/09/2021. Disponible a (https://opistobranquis.info/ca/KDGAq)

Per poder copiar aquesta cita cliqueu el botó de la dreta.

Pontes, Miquel

Informático de profesión, es fotógrafo submarino y naturalista aficionado. Submarinista desde 1994, su “logbook” cuenta con centenares de inmersiones en el mar Mediterráneo, mar Caribe y mar Rojo y en los océanos Atlántico, Índico y Pacífico. Fundador del Grupo de Estudios M@re Nostrum en 1996, socio fundador de Grup de Recerca en Opistobranquis de Catalunya en 2010, socio fundador del Grup de Recerca VIMAR (Vida Marina) en 2012. Co-autor y webmaster del web dedicado a los moluscos opistobranquios del Mediterráneo e Iberia OPK - Opistobranquis, co-autor del libro "Els nudibranquis del mar català" publicado en 2020 por Brau Edicions, descubrió el interesante mundo de los opistobranquios en 1997 de la mano de sus compañeros de inmersión y desde entonces ha sido una línea de trabajo continuada, aportando fotos submarinas, observaciones hechas en el medio natural y colaborando en la difusión de este área del conocimiento. Autor y co-autor de múltiples publicaciones científicas sobre moluscos opistobranquios (y otros grupos animales), ha participado y participa en todo tipo de proyectos divulgativos (libros, revistas, webs, conferencias, exposiciones …) como medio para difundir su interés principal: proteger los mares y los seres que los habitan. Desde 2019 es coordinador del grupo VIMAR (Vida Marina) y es webmaster de esta página web.