The use of molecular techniques to investigate the evolutionary history of animal groups and define monophyletic lineages has expanded exponentially in recent decades, becoming one of the essential steps to achieve a good integrative taxonomy.
Integrative taxonomy is an ever-evolving field based on multidisciplinary studies that combine different types of informational characters that could be diagnostic at different taxonomic levels and that are often used to elucidate phylogenetic reconstructions that were misunderstood in the past. Thus, the systematics of many taxa have recently been solved by combining molecular, ecological, behavioral, morphological and chemical data (Ekimova et al., 2015; Fernández-Vilert et al., 2021; Furfaro et al., 2018; Furfaro et al., 2021; Goodheart et al., 2018; Padula et al., 2016; Schillo et al., 2019).
Regarding molecular analysis, new genetic markers are continually being sought that can be diagnostic at different taxonomic levels and that can be added to the existing ones. Mitochondrial DNA (mtDNA) is, in most cases, the best tool to differentiate the lower taxonomic levels, such as species and genera, as well as to investigate cryptic diversity and recent speciation events (Furfaro et al., 2021 ; Pola et al., 2007; Pola et al., 2012; Furfaro et al., 2016), however it also has certain limitations that are presented in the form of errors. To avoid such errors, nuclear markers are usually included in the analysis, but these are little or not informative at lower taxonomic levels (Furfaro et al., 2021; Furfaro et al., 2016b; Galià-Camps et al., 2020).
The study of marine heterobranchs
In marine heterobranchs (Mollusca, Gastropoda) the evolutionary history, when studied at the family level, is reconstructed by using mainly three molecular markers: two mitochondrial genes, part of the I subunit of cytochrome oxidase (COI) and part of the ribosome subunit 16S, as well as the nuclear gene histone 3 (H3). By using these markers, the systematics of several families of heterobranchs have been clarified and erroneous results derived from previous morphological studies have been resolved and corrected (Ekimova et al., 2015; Padula et al., 2016; Fernández-Vilert et al., 2021) .
But it turns out that the primary sequence of some regions of mitochondrial rRNA is hypervariable and difficult to align between similar species. This rRNA hypervariability also occurs in mitochondrial ribosomal 16S RNA (16S rRNA), used as a classical marker, which folds into different domains and stem-loops, a type of structure that originates when two regions of the same chain, generally with a complementary nucleotide sequence when read in opposite directions, pair base to base to form a double helix (or stem) that ends in a loop of unpaired bases.

An example of an RNA sequence that would produce a stem-loop structure is as follows:
ACGUGCCACGAUUCAACGUGGCACAG
In this sequence, the nucleotides in bold, which are complementary, would pair up to form the stem, and the non-complementary central sequence would form the loop. Source: Wikipedia
When alignments based on the primary sequences are not easy to achieve, it is a common and suggested practice to remove these portions to stabilize the phylogenetic signal, in fact there are specific programs that help to cut these hypervariable regions, for example, the GBlocks program (Castresana, 2000; Talavera & Castresana, 2007). The removal of these unreliable alignment regions from the data set is promoted by several influential papers aimed at demonstrating the improved statistical support of phylogenetic analysis when randomness is cut off in sequence alignments (Kück et al., 2010; Privman et al., 2012). However, this practice means that, inevitably, some highly informative regions, source of diagnostic characters, are often not taken into account.
The information derived from the folded structure of 16S rRNA has not been used so far in mollusks, with the exception of two papers by Furfaro et al. (2016b; 2016c), in which this genetic marker was used with two species of sympatric sea slugs and in which a 2D structural diversity of 16S rRNA was reported, mainly using the highly variable stem-loops L7 and L13 (Lydeard et al., 2000), which shows that the information on these secondary RNA structures is a valuable additional diagnostic tool for integrative taxonomy and for species delimitation (Furfaro et al., 2016b; 2016c).
The case of the Myrrhinidae
In this line, Furfaro & Mariottini (2021) have used the comparison of the results of the phylogenetic analyzes of a set of concatenated data (the nuclear H3 gene and the COI and 16S mitochondrial markers), to investigate the systematics at a taxonomic level higher than the species level. In particular, a polyphyletic clade (Furfaro & Mariottini, 2020) composed of four genera classified in the family Myrrhinidae Bergh, 1905 was used as a case study: Dondice Marcus Er. 1958 (4 species); Godiva Macnae, 1954 (4 species); Hermissenda Bergh, 1879 (3 species) and Phyllodesmium Ehrenberg, 1831 (27 species). They chose this family as an example to investigate the ability of 2D fold structure analysis to provide useful information on the systematics of this group of animals by observing morphological and molecular characteristics. The choice was based on the peculiarity of the genera involved, their unresolved phylogenetic histories, and their unique defensive strategy: the ability to autotomize their cerata if disturbed.
After a stem-loop structure analysis of the 16S rRNA molecule, the highly variable and specific L7 stem-loop was chosen as the most divergent and informative for this group and was revealed to be diagnostic for unequivocally discriminating different 16S rRNA structures. This approach, based on the description of the “molecular morphology” of this highly variable region of mitochondrial 16S rRNA (Furfaro et al., 2016b), can be considered as an additional tool for species delimitation and integrative taxonomy in Heterobranchia and, more generally, in marine mollusks.

Source: Furfaro & Mariottini (2021)
The results confirmed the validity of the genera Godiva, Hermissenda and Phyllodesmium as traditionally conceived, but also led them to propose to exclude Dondice banyulensis from the genus Dondice and assign it as the type species of a new genus Nemesis gen. nov. However, the presence of a higher homonym, which takes precedence over the recently declared Nemesis Furfaro & Mariottini, 2021, invalidated this last genus name and invoked the need for a replacement name in accordance with ICZN rules. Therefore the authors proposed Nemesignis as the new replacement name (Furfaro & Mariottini, 2021b), under article 60.3 of the ICZN and, consequently, Nemesignis banyulensis (Portmann & Sandmeier, 1960) as its type species.

Nemesignis banyulensis by Miquel Pontes
Furthermore, the monospecific genus Nanuca (previously classified within the family Facelinidae) became synonymous with the genus Dondice and, consequently, the taxon Nanuca sebastiani was renamed Dondice sebastiani comb. nov. in the family Myrrhinidae. However, as Nanuca Er. Marcus, 1957 takes precedence over Dondice Er. Marcus, 1958, it turned out that the species of the Dondice clade should be classified under Nanuca, thus being: Nanuca galaxiana (Millen & Hermosillo, 2012), N. occidentalis (Engel, 1925), N. parguerensis (Brandon and Cutress, 1985) and N. trainitoi (Furfaro & Mariottini, 2020).
Conclusions
The 16S rRNA “molecular morphological” approach proved to be a powerful taxonomic tool for delineating both species and genus levels and is a useful way to retrieve information that is generally lost in phylogenetic analysis. We hope to see new work soon using this interesting methodology.
References
- Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol., 17: 540−552
- Ekimova, I., Korshunova, T., Schepetov, D., Neretina, T., Sanamyan, N. & Martynov, A. (2015) Integrative systematics of northern and Arctic nudibranchs of the genus Dendronotus (Mollusca, Gastropoda), with descriptions of three new species. Zool. J. Linn. Soc., 173: 841–886
- Fernández-Vilert, R., Giribet, G., Salvador, X. & Moles, J. (2021) Assessing the systematics of Tylodinidae in the Mediterranean Sea and Eastern Atlantic Ocean: Resurrecting Tylodina rafinesquii Philippi, 1836 (Heterobranchia: Umbraculida). J. Molluscan Stud. , 87: eyaa031
- Furfaro, G., Modica, M.V., Oliverio, M. & Mariottini, P. (2016) A DNA-barcoding approach to the phenotypic diversity of Mediterranean species of Felimare Ev. Marcus & Er. Marcus, 1967 (Mollusca: Gastropoda), with a preliminary phylogenetic analysis. Ital. J. Zool., 83: 195–207 DOI:10.1080/11250003.2016.1150525.
- Furfaro, G., Picton, B., Martynov, A. & Mariottini, P. (2016b) Diaphorodoris alba Portmann & Sandmeier, 1960 is a valid species: Molecular and morphological comparison with D. luteocincta (M. Sars, 1870). Zootaxa, 4193: 304–316.
- Furfaro, G., Mariottini, P., Modica, M.V., Trainito, E., Doneddu, M. & Oliverio, M. (2016c) Sympatric sibling species: The case of Caloria elegans and Facelina quatrefagesi (Gastropoda: Nudibranchia). Sci. Mar., 80: 511–520
- Furfaro, G., Salvi, D., Mancini, E. & Mariottini, P. (2018) A multilocus view on Mediterranean aeolid nudibranchs (Mollusca): Systematics and cryptic diversity of Flabellinidae and Piseinotecidae. Mol. Phylogenetic Evol., 118: 13–22, DOI: 10.1016/j.ympev.2017.09.001
- Furfaro, G. & Mariottini, P. (2020) A new Dondice Marcus Er. 1958 (Gastropoda: Nudibranchia) from the Mediterranean Sea reveals interesting insights into the phylogenetic history of a group of Facelinidae taxa. Zootaxa, 477731: 1–22
- Furfaro, G., Salvi, D., Trainito, E., Vitale, F. & Mariottini, P. (2021) When morphology does not match phylogeny: The puzzling case of two sibling nudibranchs (Gastropoda). Zool. Scr. 2021, 1–16, DOI: 10.1111/zsc.12484.
- Furfaro, G. & Mariottini, P. (2021) Looking at the Nudibranch Family Myrrhinidae (Gastropoda, Heterobranchia) from a Mitochondrial ‘2D Folding Structure’ Point of View. Life 11: 583. DOI: 10.3390/life11060583
- Furfaro, G. & Mariottini, P. (2021b) Nemesignis, a replacement name for Nemesis Furfaro & Mariottini, 2021 (Mollusca, Gastropoda, Myrrhinidae), preoccupied by Nemesis Risso, 1826 (Crustacea, Copepoda). Life 11: 809. DOI: 10.3390/life11080809
- Galià-Camps, C., Carmona, L., Cabrito, A. & Ballesteros, M. (2020) Double trouble. A cryptic first record of Berghia marinae Carmona, Pola, Gosliner & Cervera, 2014 in the Mediterranean Sea. Mediterr. Mar. Sci., 21: 191–200, DOI: 10.12681/Mms.20026.
- Goodheart, J.A., Bleidißel, S., Schillo, D., Strong, E., Ayres, D.L., Preisfeld, A., Collins, A.G., Cummings, M.P. & Wägele, H. (2018) Comparative morphology and evolution of the cnidosac in Cladobranchia (Gastropoda: Heterobranchia: Nudibranchia). Front. Zool. , 15: 1–18
- Kück, P., Meusemann, K., Dambach, J., Thormann, B., von Reumont, B.M., Wägele, J.W.; & Misof, B. (2010) Parametric and non-parametric masking of randomness in sequence alignments can be improved and leads to better resolved trees. Front. Zool., 7: 1–12
- Lydeard, C., Holznagel, W.E., Schnare, M.N. & Gutell, R.R. (2000) Phylogenetic analysis of molluscan mitochondrial LSU rDNA sequences and secondary structures. Mol. Phylogenetics Evol., 15: 83−102
- Martynov, A., Mehrotra, R., Chavanich, S., Nakano, R., Kashio, S., Lundin, K. & Korshunova, T. (2019) The extraordinary genus Myja is not a tergipedid, but related to the Facelinidae s. str. with the addition of two new species from Japan (Mollusca, Nudibranchia). ZooKeys, 818: 89
- Padula, V., Bahia, J., Stöger, I., Camacho-García, Y., Malaquias, M.A.E., Cervera, J.L. & Schrödl, M. (2016) A test of color-based taxonomy in nudibranchs: Molecular phylogeny and species delimitation of the Felimida clenchi (Mollusca: Chromodorididae) species complex. Mol. Phylogenetics Evol. , 103: 215–229
- Pola, M., Cervera, J.L. & Gosliner, T.M. (2007) Phylogenetic relationships of Nembrothinae (Mollusca: Doridacea: Polyceridae) inferred from morphology and mitochondrial DNA. Mol. Phylogenetics Evol., 43: 726–742.
- Pola, M., Camacho-Garía, Y.E. & Gosliner, T.M. (2012) Molecular data illuminate cryptic nudibranch species: The evolution of the Scyllaeidae (Nudibranchia: Dendronotina) with a revision of Notobryon. Zool. J. Linn. Soc., 165: 311–336.
- Privman, E., Penn, O. & Pupko, T. (2012) Improving the performance of positive selection inference by filtering unreliable alignment regions. Mol. Biol. Evol., 29: 1−5.
- Schillo, D., Wipfler, B., Undap, N., Papu, A., Boehringer, N., Eisenbarth, J.H. & Wägele, H. (2019) Description of a new Moridilla species from North Sulawesi, Indonesia (Mollusca: Nudibranchia: Aeolidioidea)—Based on MicroCT, histological and molecular analyses. Zootaxa, 4652: 265–295
- Talavera, G. & Castresana, J. (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol., 56: 564−577
Cite this article as:
Pontes, Miquel (2025) "New molecular techniques for taxonomic determination in Heterobranchia" in OPK-Opistobranquis. Published: 12/08/2021. Accessed: 17/08/2026. Available at (https://opistobranquis.info/en/?p=32730)
